The metabolic modelling community has established the gold standard for bottom-up systems biology with reconstruction, validation and simulation of mechanistic genome-scale models. Similar methods ...
A little bit of computer science has made it possible to reduce the time it takes to find new genes from years to milliseconds. Researchers at Stanford University have developed a simple processing ...
instead of the original, incorrect ‘CGAGGTGCTTTTAGCACCTCGAAGTAAAGCTATCCACTGTCACCAACTACTAGATAAACGTCACACTTTTCGTGTGAC’ where the final ‘G’ was omitted. This has ...
Results that may be inaccessible to you are currently showing.
Hide inaccessible results